Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
Iterative rounds of testing with 4 6 adolescents per round were conducted until data saturation was achieved.
Similar(59)
The first round was conducted during the beginning ofJanuary 2009; i.e., the Ethiopian Christmas season.
Each selection round was conducted as follows: 1011 plaque-forming units were added on immobilized negative target (EGFR) in 96well plates.
The first round was conducted with HTOmspS1 (ACAGTGCAGGGAAAGAATAG) and HTOmspAS1 (ATGGTGAATTGATCCCATCTTG) primers; the second - with primers HTOmspS2 (TTCGTTGGGAGTGAATTAG) and HTOmspAS2 (CAGGGGAAAGAATAGTAGAC).
The first round was conducted using primers 5'tatacgtaagccacctggattc3' (3762-3783 nucleotide positions relative to HXB2) and 5'cagtctacttgtccatgcatggcttc3' (nt relative positions 4371-4396) with an annealing temperature of 55°C.
The first vaccination round was conducted August 5 9 , 2013
A second round was conducted between 2001 and 2003.
The first breast cancer screening round was conducted from February 2008 to December 2009.
Individuals with more than four recombinations were removed and a second CRIMAP analysis round was conducted.
Prior to our collections, an IRS round was conducted in Mongola from September 29 , 2008to October 2, 2008.
For instance, there has been no epidemic outbreak and the December polio round was conducted normally.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com