Sentence examples for round was conducted from inspiring English sources

The first round was conducted during the beginning ofJanuary 2009; i.e., the Ethiopian Christmas season.

The Finns finished one position higher at the 1999 World Championship; The tournament's medal round was conducted in a two-game series format followed by a ten-minute sudden victory overtime if the each team wins one game.

Each selection round was conducted as follows: 1011 plaque-forming units were added on immobilized negative target (EGFR) in 96well plates.

The first round was conducted with HTOmspS1 (ACAGTGCAGGGAAAGAATAG) and HTOmspAS1 (ATGGTGAATTGATCCCATCTTG) primers; the second - with primers HTOmspS2 (TTCGTTGGGAGTGAATTAG) and HTOmspAS2 (CAGGGGAAAGAATAGTAGAC).

The first round was conducted using primers 5'tatacgtaagccacctggattc3' (3762-3783 nucleotide positions relative to HXB2) and 5'cagtctacttgtccatgcatggcttc3' (nt relative positions 4371-4396) with an annealing temperature of 55°C.

A second round was conducted between 2001 and 2003.

Iterative rounds of testing with 4 6 adolescents per round were conducted until data saturation was achieved.

A Delphi consensus procedure consisting of three rounds was conducted.

A Delphi consensus process in three rounds was conducted.

*In Gredaya, 3 vaccination rounds were conducted jointly between veterinarians and public health professionals and another 3 rounds were conducted by the public health sector alone to fully immunize children, whereas in Chaddra/AmDobak, only 1 of 6 rounds was conducted jointly with the veterinarians.

Safety rounds were conducted three days a week ascertaining 37 safety measures (grouped into 10 blocks).