Sentence examples similar to round of site from inspiring English sources

Suggestions(1)

Similar(60)

In PMA, the next migration points for sinks are determined as follows at each round of sink site determination.

Transforming the building's various unused spaces into sculptural environments is the challenge faced by seven artists who were invited to participate in the museum's latest round of site-specific installations.

After one round of site-directed saturation mutagenesis, improved variants of the two best designs, RA114 and RA117, exhibited among the highest kcat (> 10− 3 s− 1) and kcat/KM (11 25 M− 1 s− 1) values observed for retroaldolase designs prior to comprehensive directed evolution.

Here, we show that a single round of site-saturation mutagenesis and screening enabled the identification of β-fucosidases that are significantly more active (180-fold increase in kcat/KM in reactions with the novel substrate) and specific (700,000-fold inversion of specificity) than the best variants in the previous study.

The same Internet service provider that hosted those sites was attacked again in early May, infecting another round of sites with malware designed to exploit users.

When ART scale up started in 2004, three army medical clinics were included in the first round of sites, and a fourth army clinic was added in mid-2005.

A round of site-directed mutagenesis was used to produce DmK-C338S, based on the DmK-CL construct.

In order to generate the Syt7C2AB-FE4 plaseconda second round of site-directed mutagenesis was performed with the following primers: fwd, CAGCGATGGGAGCGGGAGCTCGAGTGGGAG; rev, CTCCCACTCGAGCTCCCGCTCCCATCGCTG.

The resulting 'stacked' site, as expected, contained attL and attR between each construct, the number of which would increase with each round of site-specific integration.

The single recombination site in the SMG-free SSI site serves as the target for the next round of site-specific integration.

For double mutations, a second round of site-directed mutagenesis was performed utilizing pRSFDuet-1nisAB-M21P as the plasmid template for the generation of NisA N20P/M21P and M21P/K22P mutants.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: