Sentence examples for revert the sequence from inspiring English sources

Exact(1)

If these apparent lineage-specific indels are supported only by low-quality sequence, we conclude that they are more likely to result from sequencing errors than from true evolutionary events, and we revert the sequence to the inferred ancestral indel state.

Similar(59)

The intermediate strain was also transformed with an oligo (5′-CACAACAAGGCGCTGGCGATGGGCGGCATCTTCGGTGGCGAACACTCTGGCGTGAATGACGAAACACAAA) that would revert the strain back to the wild type pheT sequence.

Blocking strategies to revert the atopic response to TPA treatment.

If this happens, simply revert the change.

Click the "Revert Version" button to revert the page back to that version.

We next reverted the gltA1 mutation to the wild-type sequence (gltA wt) in both strain backgrounds.

The latter mutation reverted the HpSVd-hop isolate to the natural HpSVd-grapevine sequence.

None of the mutations reverted the original or598ts mutation (D319G) back to the WT sequence; however, one allele changed this residue to a serine.

The deRIP process involves scanning a multiple alignment of a repeat family for RIP-like polymorphism and reverting the alignment consensus to the putative pre-RIP-mutated sequence.

Individually reverting the recA, dnaB, and yfjK alleles back to the Founder sequence resulted in 1 2 log decreases in resistance.

Here, we report the NMR structure of another mutant, derived from the tetramer by reverting the single amino acid position F26 back to the wild-type sequence A26.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: