The best PVSC achieves a PCE of 20.10 19.855)% measured under reverse (forward) voltage scan.
Recently, reverse and forward genetic studies revealed several clock genes in Chlamydomonas.
The defeat at Hoffenheim was typical of his stop-start-reverse-forward reign at the Veltins-Arena.
For each edge that represents an ordered pair of nodes with overlapping reads, four possible types exist, according to the directions of the two reads: forward-forward, reverse-reverse, forward-reverse, and reverse-forward.
Tip-to-tip contacts between SNX-BAR dimers: SNX1K442A forward gctgctgtgggccaacgcgcctgataagctgcag, reverse ctgcagcttatcaggcgcgttggcccacagcagc; SNX1K445A forward ggccaacaagcctgatgcgctgcagcaggcca, reverse tggcctgctgcagcgcatcaggcttgttggcc.
The primer used in this study are (5'-3'): GYS1, forward (TTCTACAACAACCTGGAG) and reverse (CTGAGCAGATAGTTGAGC); GYS2, forward (TTACCAGCATGCCAGACAC) and reverse (AGAAGGTGGTACTGAGG); HIF 1alpha, forward (GTTTACTAAAGGACAAGTCACC) and reverse (TTCTGTTTGTTGAAGGGAG); β-actin forward (CCCAGAGCAAGAGAGG) and reverse (GTCCAGACGCAGGATG).
fwd = forward; rvs = reverse.fwd = forward; rvs = reverse.
Primer sequences were as follows: GAPDH, forward ggagtcaacggatttGG tcgt, reverse gttgaggtcsstgaaggggtca; p16, forward cggaaggtccctcagacatc, reverse ccctgtaggaccttcggtga.
Primer sequences and the number of cycles were as follows: β-tubulin: forward: ATGAGGGAAATCGTG; reverse: AGTGGGTCAGCTGGAAGC; γ-tubulin: forward: AGTTGGCCAACTTCATCC; reverse: TGCCCCAGGAGATGTAGT; STOP: forward: GAGCAGCTCCTACAGGAATGA; reverse: TGAAGGGTTCDCTGTAGAGG.
The sequences of primers used in real time PCR analyses were as follows: type-2 collagen forward AGGGCAACAGCAGGTTCACATAC; reverse TGTCCACACCAAATTCCTGTTCA. Aggrecan forward AGTGGATCGGTCTGAATGACAGG; reverse AGAAGTTGTCAGGCTGGTTTGGA. Sox9 forward CAGTACCCGCATCTGCAC; reverse TCTCTTCTCGCTCTCGTT.
