Your English writing platform
Discover LudwigExact(9)
In this study, we investigate the elastic unloading and reverse yielding behaviours of cylindrical and spherical cavities in a bounded cohesive frictional medium.
The paper presents a novel concept of an autofrettage compounded tube which has been modelled for the autofrettage process by using a Huang's model (2005) for modelling reverse yielding due to Bauschinger effect.
Of particular interest is the critical state when reverse yielding in the hollow cylinder/sphere is imminent in relation to the cavity pressure, the cavity dimensions, as well as the material properties.
For wire-winding, since tangent and/or Young's modulus could be changed in autofrettage unloading step or during reverse yielding according to material behavior, a capable approach is applied.
A key implication of the simulations is that the incidence of reverse yielding upon reheating differentiates between systems that exhibit a systematic increase in imperfection amplitude upon thermal cycling (ratcheting) and those that exhibit shakedown.
Not another boom that redistributes wealth from middle class families to financial executives while sapping public coffers, but one that works in reverse, yielding reinvigorated communities built to last, adapt and thrive.
Similar(51)
More significantly, he found the reaction could be reversed, yielding pure nickel, which could then be deposited as a plate on to other materials.
SCNT and transcription factor-based reprogramming experiments demonstrated that a terminally-differentiated somatic cell fate can be reversed, yielding a pluripotent state.
They were accordingly assigned values from 1 to 4 (the scoring of the first and last items were reversed), yielding a maximum total score of 16.
Primers used to determine genotypes are UCHL1 forward: tggacggctgtgtgtgctaatg, wild-type (WT) reverse: ctaagggaagggtcttgctcatc, mutant (Mt) reverse: gtcatctacctgaagagagccaag, yielding 668 bp WT and 334 bp Mt PCR products, respectively.
In this work we describe an Endex Calcium Looping reactor, in which heat released by chemisorption of carbon dioxide onto calcium oxide is used directly to drive the reverse reaction, yielding a pure stream of CO2 for compression and geosequestration.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com