Sentence examples for reverse reverse from inspiring English sources

In summary, the primer combinations were: head forward (forward = +); head forward+head reverse (reverse = −); head reverse; head forward+tail forward; head forward+tail reverse; head reverse+tail forward; head reverse+tail reverse; tail forward; tail forward tail reverse; tail reverse (sequences listed in table 3).

The assembled SpPKC1 sequence was used to design the following primers: GTGGATAATTTTTGCTGGATTTGCGCCTTGA, (forward; ends 13 bp upstream of start codon) and GTTCTACAGACAGACTGGCA CTAGCT (reverse; reverse complement of stop codon underlined).

The second most abundant dinucleotide motif was CAn (including the reverse, reverse complement, and complementary permutations: AC, GT, and TG) accounting for 15% of all motifs and 30% of all dinucleotide repeats.

One ng of total RNA was added to 50 μl of PCR mixture containing UCP-2 or -3 specific primers (0.2 μ M each of forward and reverse), reverse transcriptase, DNA polymerase, MgCl2 (1.5 m M) (OneStep® Abgene, Epsom, Surrey, UK).

When combined with the fact that two strands of template DNA are involved, and any combination of semispecific sites for both the forward primer and the reverse primer (i.e., forward with forward, forward with reverse, reverse with forward, reverse with reverse) can cause mispriming, having two sites close to each other on opposite template strands is quite possible.

Reverse: Reverse the audio completely.

(x: y) inserts x into the front of list y. reverse reverses a list.

Or is it reverse-reverse psychology?

You may wince at reverse-reverse-sweeps and ramps over the keeper's head.

An assessment on Salon called the spots "reverse-reverse psychology" meant to "convince teens and 20-somethings to eat carrots because it'd be ironic and funny and they'd be in on the joke".

For each edge that represents an ordered pair of nodes with overlapping reads, four possible types exist, according to the directions of the two reads: forward-forward, reverse-reverse, forward-reverse, and reverse-forward.