Sentence examples for reverse reference from inspiring English sources

I suggest doing a few reverse reference checks.

To reduce alignment errors, we also align the reverse query sequence to the reverse reference sequence, namely reverse reverse alignment, in addition to the forward forward alignment.

At heterozygous positions sequenced bidirectionally, the minimum number of original template molecules required to produce a signal is only four: forward reference, forward alternate, reverse reference, and reverse alternate.

Likewise, a reverse scoring vector r = (r1, r2,···, r n) is computed from the reverse scoring alignment matrix S R where r j is the maximum score of the best suffix consensus alignment c nc n−1 ··· c j to the reverse reference.

The article also reversed references to the new bill: Jackson seems to be missing his left shoulder, not his right, and the words "Twenty USA" and "USA Twenty" are on his left side, not his right.

We now define analogous indices to Eqs. 5 and 7 reversing the reference current and base periods for the network infrastructure and population levels, respectively.

It contained modified DNA polymerase, SYBR Green I, 5 mM MgCl2, dNTP mix, 0.5 µM of forward and reverse primers, 1×ROX reference dye, and 100 ng of the first strand cDNA in deionized water.

SNP rs761142 was genotyped using allele specific PCR (common forward primer: CAACAGTTGGTTCTAGCAAAAGGA; reverse primer for reference allele: CCACACTGCTGGCTCTCTTGTAA; reverse for variant allele: CCACACTGCTGGCTCTCTTGTAC) as described [ 47].

Analysis populations composed of 100,000 unique reads, their start position (in base pairs), read length (in bases) and their orientation (forward or reverse) on the reference genome were randomly sampled from each of the pooled sequences from amplified genomic material.

The strategy to "reverse engineer" a reference organism (with a desirable property such as higher yield) is carried out by identifying the genetic or molecular basis of the property and subsequently reengineering the property into target organisms of interest by considering the key genes involved in complex mechanisms controlling microbial metabolism [ 80].

Correction: October 7 , 2001 Sunday A report last Sunday about the wedding of Elizabeth Falk and Martin Piecuch reversed the references to their previous marital status.