Sentence examples for reverse rank from inspiring English sources

Suggestions(1)

Exact(3)

Primers used in this study were as follows: GAPDH, 5'- CCAATGTGTCCGTCGTGGAT-3' (forward) and 5'- TGCTGTTGAAGTCGCAGGAG -3' (reverse); RANK, 5' -CTGCCTCTGGGAACGTGACT -3' (forward) and 5'- GCGAGGTCTGGCTGACATAC-3' (reverse).

More generally, Zipf's law is the statement of a power law, when plotting frequency against rank (Zipf's first law) or when plotting frequency against reverse rank (Zipf's second law).

In this table, the proposed RS measures gave a better rank of RPN8 (#29) than that of RSC1 (#117), but all the other five RS measures gave a reverse rank order.

Similar(57)

A value of zero indicates the absence of correlation between the rankings and reverse ranking is implied by a value of -1.

The rank correlation plot is confusing as well because of the reverse ranking for the gene essentiality.

Then, for each gene B that was among the top 5000 we assigned a gene-essentiality (GE) rank as '5000 – rank of gene B in the essentiality screen' (a reverse ranking).

Analysis of item clustering on exploratory factor analysis showed a trend toward the same factors found in the original factor analysis of the instrument [ 12], although a reverse ranking of factors in terms of explained variance was observed.

The wt RANK- transfected cells were able to endure doxorubicin cytotoxicity and this phenomenon was reversed when wt RANK and RANK-c were co-expressed.

But more Long Islanders cited traffic than crime as a problem, reversing the ranking in the city and the other suburbs.

But the remarkable comeback last year — and solid returns for the two years prior — have reversed what ranks among the most stunning falls from grace in an industry brimming with schadenfreude.

Reverse-chrono ranking makes it easy to see if any friends are doing something fun right this minute that you might want to join.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: