Sentence examples for reverse product from inspiring English sources

Exact(8)

The skill upgrading contribution of TNCs is related to the type of factories located in Vietnam and the role they play in regional production networks using a model combining the reverse product cycle and regional waves of FDI.

An article in The Harvard Business Review last year mulled "reverse product placement" as a strategy for starting new brands, pointing to the imaginary Sprunk brand of soda in the game Grand Theft Auto as a possible candidate.

These financial service sub-sectors are associated with innovations in products, processes (Batiz-Lazo and Woldesenbet, 2006), and services (Barras, 1986), which can occur either through a normal product life cycle or through what Barras (1986) calls a reverse product cycle.

Methylation-specific PCR primers for P3H3 were: 5′-GAGGTAAGGTTGGGGTTTTTC-3′ (methylated forward); 5′-CAACCACGTAAACAACTACTACGAT-3′ (methylated reverse), product size, 97 bp; 5′-AGGTAAGGTTGGGGTTTTTTG-3′ (unmethylated forward); 5′-CCCAACCACATAAACAACTACTACA-3′ (unmethylated reverse), product size, 98 bp.

Methylation-specific PCR primers for P3H1 were: 5′-GTTTTTTAAGTCGAGGTCGAGTTC-3′ (methylated forward); 5′-ACTAAATACGACAACGCAAACG-3′ (methylated reverse), product size, 180 bp; 5′-TTTTAAGTTGAGGTTGAGTTTGA-3′ (unmethylated forward); 5′-CACTAAATACAACAACACAAACAAA-3′ (unmethylated reverse), product size, 172 bp.

The t(4 7) was not precisely reciprocal as the expected reverse product was not found by PCR.

Primer sequence for P3H2 were: 5′-ATTTGTATAATTAGAAGGGAGTTTA-3′ (forward); 5′-AACAACAAAAAAAACTCAAAAAAAC-3′ (reverse), product size, 937 bp.

Show more...

Similar(4)

Findings show that entrepreneurs and companies offering frugal and reverse products and services manage to combine the business model elements in an insightful manner and create economic, social and environmental value.

As described above the respective forward and reverse products were mixed with vector, treated with UDG and allowed to anneal.

Primers were designed for ACT2A, forward TTCAATGTCCCAGCCATGTA and reverse GAAGGAATAGCCACGCTCAG, product size 222 bp from NCB1 Reference sequence NM_001141945.1 and COL1A1, forward TTCTGCAACATGGAGACTGG and reverse CGCCATACTCGAACTGGAATC, product size 151 bp from reference sequence NM_000088.3.

Pair 1 (forward: 5'-CTGTAGCGGCTGATGTTGAA, reverse: ATGGCGATTACCGTTGATGT, product: 299 bp) detects the LacZ reporter gene and differentiates between wild-type (wt) and heterozygous/homozygous mice.

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: