Sentence examples for reverse producing from inspiring English sources

The waves are then reflected back from areas where there is a change in density and on their return the transducer works in reverse, producing a signal which the scanner can process into a digital image.To make a transducer by painstakingly micro-machining a brittle block of ceramic material can take many hours of work, though.

If the primary acetate is treated with water, a hydrolization reaction can occur in which the acetylation reaction is partially reversed, producing a secondary cellulose acetate, or cellulose diacetate.

As a control for the auditory stimulation, a Reversed Speech condition was included during which the recordings used in the Speech condition were digitally reversed, producing meaningless strings of auditory stimulation and maintaining spectrotemporal complexity (as used by Crinion & Price, 2005).

When unemployment was compared with employment in 2001 (ages 45 49 years) with follow-up to 2010, the pattern of mortality risk (4271 deaths) stratified by education was reversed, producing adjusted HRs of 2.81 (2.47 to 3.21) for compulsory education, 2.87 (2.58 to 3.19) for up to 3 years postcompulsory education and 3.44 (2.78 to 4.25) for more than 3 years postcompulsory education.

The GAPDH primers 5′-TTGGTATCGTGGAAGGACTCA-3′ (forward) and 5′-TGTCATCATATTTGGCAGGTT-3′ (reverse) produced a 270-bp amplicon (Ogawa et al, 2004).

Most students who used Analogies, Personas, mind mapping, purge, and/or reverse brainstorming produced unique ideas, a variety of concepts as well as technological innovations.

In contrast, rearrangement of the modified analogues by C,N-half-exchange and reverse analogues produced activity similar to that of the original penetratin.

If subjects were to select button A on every choice in the RO task, they would experience a temporary decrease in earned reward that would subsequently reverse to produce the maximum average return (Figure 1B).

The 28S rRNA gene was amplified with primers fD1 (forward, AGCGGAGGAAAAGAAACTA) and rP2 (reverse, TACTAGAAGGTTCGATTAGTC), producing an amplicon of approximately 1500 bp.

The participants completed four conditions in one of four preset orders consisting of 24 trials per condition, which were all then repeated in the reverse order, producing 48 trials for each of them.

The competitor primer was designed 117 bp upstream of the reverse primer producing a product 277 bp long.