Sentence examples for reverse lay from inspiring English sources

You can also try the reverse lay up in which you go all the way around the basket and do the layup on the other side.

If you're right-handed, the left-handed lay up may also be referred to as a reverse lay up, since it's the reverse of your standard lay up.

Of his time at Congressional, MacDonald once said, "It was the 10 Commandments in reverse: lie and steal, kill, maim, spy".

Much of the blame for the brutality of this reverse lies with the country's biggest firms, the chaebol, which dominate the economy.Unbeknownst to shareholders and analysts the chaebol had taken on billions of dollars of debt and other liabilities from sister companies and others.

On the reverse, lies the imperial orb and the Latin inscription In memoriam recuperatæ dignitatis a vitæ 1708 (English: In remembrance of the restoration of the original dignity, 1708).

Perhaps the easiest way of understanding government policy is to completely reverse whatever lie they're claiming is truth.

GarsC201R PCR primers (forward: CACGTGCTTGCTCTAGCAAGA; reverse: GTCTACCACTGAACACAGTCC) lying within intron 4 and intron 5 respectively, (spanning exon 5 of Gars) were used to amplify a 420 bp product.

We amplified sequence using forward primers from either exon 1a (DIC2_Ex1a for) or exon 1b (DIC2_Ex1b for) and one reverse primer lying in the last exon of the gene (DIC2_Ex18 rev) (Primer sequences used to determine the splicing patterns of Dync1i1 and Dync1i2 are given in Table S2).

To perform the side plank reverse fly: Lie down on your side on the floor and prop yourself up with either your hand or elbow.

The only realistic means of resisting or reversing this lies at the highest political level and, with Labour improving in the polls, the party's messages on the NHS are now taking on huge significance.

Then Pierce hit a reverse lay-up.