Sentence examples for reverse indices from inspiring English sources

We used 16 forward index sequences SA501 SB508 and 24 reverse indices SA701 SB712, allowing a total of 384 unique combinations for sample indexing (Additional file of Kozich et al. [ 16]).

For the reverse indexes, p = 4 when x ≤ b 1.  .

For the reverse index, p = 1 when x ≥ b 4. II-grade index.

This was its initial purpose: reverse index creation and page rankings, essentially weighted sums.

For the reverse index, p = 1 when x ≥ b 4.   2.

Q-component de-interleavers also can be implemented by the simple reverse index-based look-up table operations.

Then, suppose that a 1 < a 2 < a 3 < a 4 and b 1 < b 2 < b 3 < b 4 are the grading scores of the positive and reverse indexes, respectively.

Similar to the graph indexing technique used in GraphGrep [ 17], the second data structure is a reverse index from the edge pattern to the subgraphs.

The second one is Apache Lucene [ 29], a state-of-the-art search engine based on look-up of similar documents through a reverse index and relevance ranking based on a TF*IDF-weighted vector space model.

A final PCR was done in a 50 μL reaction using KAPA HiFi DNA Polymerase (5 U), 8 pmol Illumina forward adapter (5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC), Illumina reverse index primer (5′CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGT) and 5 μL purified ligation reaction.

The PCR cycle was 95°C for 3 min, 15 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 1 min, and final extension at 72°C for 5 min. The 6 bp indexes (XXXXXX in reverse index primer above) used were AAGCTA (HAMBI 490), CGTGAT (HAMBI 1145), TTAGGC (HAMBI 1146), GGAACT (HAMBI 1189), ATTATA (HAMBI 2427), GGCCAC (HAMBI 2566), CCGGTG (HAMBI 2605) and GTATAG (HAMBI 2610).