"reverse index" is a correct and usable term in written English.
It usually refers to the process of indexing content in an inverted order. For example, "The database was indexed using a reverse index to allow for quicker searches."
For the reverse index, p = 1 when x ≥ b 4. II-grade index.
This was its initial purpose: reverse index creation and page rankings, essentially weighted sums.
For the reverse index, p = 1 when x ≥ b 4. 2.
Similar to the graph indexing technique used in GraphGrep [ 17], the second data structure is a reverse index from the edge pattern to the subgraphs.
The second one is Apache Lucene [ 29], a state-of-the-art search engine based on look-up of similar documents through a reverse index and relevance ranking based on a TF*IDF-weighted vector space model.
A final PCR was done in a 50 μL reaction using KAPA HiFi DNA Polymerase (5 U), 8 pmol Illumina forward adapter (5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC), Illumina reverse index primer (5′CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGT) and 5 μL purified ligation reaction.
Q-component de-interleavers also can be implemented by the simple reverse index-based look-up table operations.
For the reverse indexes, p = 4 when x ≤ b 1. .
Then, suppose that a 1 < a 2 < a 3 < a 4 and b 1 < b 2 < b 3 < b 4 are the grading scores of the positive and reverse indexes, respectively.
We used 16 forward index sequences SA501 SB508 and 24 reverse indices SA701 SB712, allowing a total of 384 unique combinations for sample indexing (Additional file of Kozich et al. [ 16]).
A detailed explanation, as well as the pseudo-code of the algorithm, can be found in Additional file 2. This procedure needs only the reverse CGR index of S, without using any special index data structure.
