Sentence examples for reverse index from inspiring English sources

"reverse index" is a correct and usable term in written English.
It usually refers to the process of indexing content in an inverted order. For example, "The database was indexed using a reverse index to allow for quicker searches."

Exact(7)

For the reverse index, p = 1 when x ≥ b 4. II-grade index.

This was its initial purpose: reverse index creation and page rankings, essentially weighted sums.

For the reverse index, p = 1 when x ≥ b 4.   2.

Similar to the graph indexing technique used in GraphGrep [ 17], the second data structure is a reverse index from the edge pattern to the subgraphs.

The second one is Apache Lucene [ 29], a state-of-the-art search engine based on look-up of similar documents through a reverse index and relevance ranking based on a TF*IDF-weighted vector space model.

A final PCR was done in a 50 μL reaction using KAPA HiFi DNA Polymerase (5 U), 8 pmol Illumina forward adapter (5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC), Illumina reverse index primer (5′CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGT) and 5 μL purified ligation reaction.

Show more...

Similar(51)

Q-component de-interleavers also can be implemented by the simple reverse index-based look-up table operations.

For the reverse indexes, p = 4 when x ≤ b 1.  .

Then, suppose that a 1 < a 2 < a 3 < a 4 and b 1 < b 2 < b 3 < b 4 are the grading scores of the positive and reverse indexes, respectively.

We used 16 forward index sequences SA501 SB508 and 24 reverse indices SA701 SB712, allowing a total of 384 unique combinations for sample indexing (Additional file of Kozich et al. [ 16]).

A detailed explanation, as well as the pseudo-code of the algorithm, can be found in Additional file 2. This procedure needs only the reverse CGR index of S, without using any special index data structure.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: