Sentence examples for reverse having from inspiring English sources

Ms. Treisman has the same history, but in reverse, having come to college at Berkeley after growing up in England and going on to become the managing editor of Grand Street, an American literary journal.

That was the first meeting between the sides, but Anzhi will be confident of exacting revenge for that reverse, having won their last four European home matches without conceding a goal.

The exon 2 of pvtrag33.5 gene was PCR amplified from the P.vivax DNA using primers, 5'-TGTAGTCGACTCAAAGCGCAGTAG-3' (forward) and 5'TTGTTCCTAATTGAGTCTAGAATTCC3' (reverse) having SalI and XbaI sites (underlined) respectively.

"Instead the reverse has happened.

The reverse has happened.

In fact, the reverse has happened.

So far, the reverse has happened.

The reverse has occurred with Alzheimer's.

In fact, the exact reverse has happened.

Recently, though, the reverse has been true.

The reverse has happened with the economy.