Sentence examples for reverse ends from inspiring English sources

The PCR primers, TLR7F-1/TLR7R-1 and Table-2/TLR7R-2 (Table  1), with restriction enzyme sites were used to the forward and reverse ends of the target fragment.

The 1,152 clones were rearrayed into 96 well plates (CHORI, Children's Hospital Oakland Research Institute) and both ends of each clone were sequenced (Macrogen Inc., Seoul, Korea) using the universal T7 primer and the modified universal SP6 primer (ATTTAGGTGACACTATAGAAGG) for PCR amplifications at the forward and reverse ends, respectively.

Another swerving reverse ended with a crunch of bumpers.

The retrospective almost works in reverse, ending with one of his earliest series: A Storybook Life.

Indeed, "Evil Nigger" runs the story in reverse, ending in spaced-out atonality.

The 2-1 defeArsenalenal's third successive home reverse, ended their most realistic chance of landing silverware this season.

The reverse ended a run of four consecutive victories for the Saints, but what should exercise them this week is their finishing.

So my model is kind of a reverse "end result justifies the means".

Absent or reverse end-diastolic velocity in the umbilical artery of the twin with selective intrauterine growth retardation was required for eligibility after January 2000.

Absent or reverse end-diastolic flow (Doppler II/III) in umbilical artery is correlated with poor perinatal outcome, particularly in intrauterine growth restricted (IUGR) fetuses.

Objective: This study was designed to establish whether, in growth-retarded fetuses, absent or reverse end-diastolic (ARED) flow velocity in the umbilical artery can be predictive of an increased incidence of long-term neurological and intellectual impairment.