Sentence examples for reverse containing from inspiring English sources

And at her best, she is able to perform this in reverse – containing limitless canyons, plains and skies in her poised and carefully delineated folds and structures.

PCR primer sequences were as follows: 5′-GAGGATCCACCATGATGCAAGAATCTGGGACTGAGACAAAG-3′ (forward) and 5′-CACAAGCTTTCACTCCATGTCCTCGTTTACTGGTTC-3′ (reverse), containing restriction sites for BamH I and Hind III, respectively.

Nhe1 and Bgl II sites were engineered into the promoter regions by nested PCR to isolate 1370 bp directly upstream of the start codon using the primers 5′-GTGATCTTACGCTAGCTTCCTGCGTTCTGAGG (forward containing Nhe1) and 5′-CGAACTGTCTAGATCTCACTGCCGCTGCCTCTCG (reverse containing BglII).

Eco29kI REase and MTase genes were amplified from the natural plasmid pECO29 with primers TTT GTCGAC ATGCACAATAAGAAATTTGATA (forward; containing start ATG codon shown in bold) and CCT GGATCCCTT TTAATTGAAGTTAGAGCACAA (reverse; containing stop TTA codon shown in bold), carrying SalI and BamHI sites, respectively, for subsequent cloning [ 5].

A DNA fragment corresponding to bases -25 to 967 (from the start codon) of the genomic sequence of PpHsp16.4, including the entire coding sequence of the gene and lacking the stop codon, was PCR amplified from P. patens genomic DNA using the primers "gtggtaccttggtcaacttgagagaa" (forward) and "atcgatatctccccccatagtcacctc" (reverse), containing KpnI and EcoRV restriction sites, respectively.

The reverse contains the denomination "2 cents" with a somewhat ornate wheat wreath.

The primers used for PCR, GGGGTACC TGCACCCAATCCACACCCACTAAGA (forward) and CGGG ATCCACTGTCAAGGCGCAAATCCAGCAA (reverse), contain Kpn1 and BamH1 sites, respectively, which are compatible with the multiple cloning sequence in pGLII.

The connectedness scale (reversed) contains items related to an adolescents' feelings of commitment and connection to school both social and academically.

Ji and Xue (2002) obtained the mean working dimensions from the reverse chain matrix containing reverse tolerance chains.

The reverse primer contained the reverse complement of both the predicted translation termination codon and the preceding 20 25 nucleotides at the end of the ORF (Supporting Information Table S1).

The full length cDNA was PCR amplified with forward and reverse primers containing BamH1 and EcoRI sites, respectively.