Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
For each sample, a 20 μl reaction was set up in LightCycler capillaries containing 1 μl of 100 ng of leaf tissue TNA was added to 4 μl LightCycler ® FastStart DNA MasterPlus SYBR Green I (Roche), 1 μl forward coat protein primer (10 μM) 5′ACGTCCGTCGCAAGTACGAT3′, 1 μl reverse coat protien primer (10 μM) 5′ATTGTCATGTCGAATAGTACG 3′ and 14 μl nuclease-free water.
Similar(56)
From the 3-roll coating experiments with forward and reverse coating modes, the operability windows in the coating process, demarcating the uniform coating flow from defects, were established.
In particular, it was possible to elucidate the relationship between the capillary number and speed ratio conditions for the desired coating thickness in roll coating systems accompanied with reverse coating mode between the pick-up and metering rolls.
From that date, by ordinances of Charles III, silver coinage carried on the face a bust of the reigning monarch and on the reverse the coat of arms, a system already utilized in the gold pieces.
Reverse roll coating is probably the most widely used coating operation, yet its full potential has not been exploited as it is shown in this paper which considers operation with a negative gap.
Indeed the cascade speeds conform to correlations developed for reverse roll coating.
A key feature of the mathematical models is that, unlike previous reverse roll coating studies, the variation of dynamic contact angle with metering roll speed has been accounted for.
This process creates layers of polyvinyl alcohol (PVA) nanofibers filled with silicon nanoparticles (Si NPs) and carbon nanotubes (CNTs), while eliminating conventional slurry steps such as sonication, grinding, ball milling and doctor blading or slot and reverse roll coating.
It was also observed that cascade occurred in the pre-metered regime because the dynamic wetting line XD, moves near the minimum gap position just as in reverse roll coating.
An industrially-important variant of reverse roll coating is studied in which the metering gap sits beneath a large, liquid reservoir, the influence of which is investigated via complimentary experimental, analytical (lubrication) and computational (finite element) methods, and for which gravitational effects are shown to be influential.
The stamps were officially described by an Avis ministériel ("Ministerial notice") of 1849 as each being a "small engraving representing the portrait of the King, with indication as to their value...they will be printed on a paper of which the reverse is coated in a thin layer of glue".
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com