Sentence examples for return sequence from inspiring English sources

Further, the different portions of the beam elevation therefore map to different ranges, and the return sequence can be directed into different range bins.

This is a key advantage of targeted assembly, since alignment of NGS sequence to a complete reference would not be expected to return sequence reads that contained a significant number of non-reference bases.

In the case of C GC = 75%and50%50%, RNAiFold fails to return sequences (Fig. 4d) that fulfill the specified constraints.

A standard call-save-return sequence is used for all interprocedure reference in Multics.

The fact is, when using low withdrawal rates, retirees will typically leave behind a large pot of wealth (unless their retirement returns sequence matches the worst-case scenario).

1D H NMR spectra for hamster and mouse Nat2 were collected at 20 °C using a jump-return sequence.

Imino proton spectra at 5 °C were obtained using a phase-sensitive jump-return sequence and referenced relative to that of DSS.

The downfield region of the H 1D spectra, collected with a jump-return sequence, of mouse and hamster Nat2 also show a similar pattern of peaks (Fig. 6A and B).

For these, the initial 5' sequencing returned sequence for eighty-six percent (3936) of the clones (Genbank CN468542 – CN472211 for clones > 150 bp).

Specifically, we found that on average approximately 80bp on either side of a given 120bp target region returned sequence of acceptable depth to call SNPs.

In order to maximize usable returned sequence data, a combination of three primers were utilised separately for each clone: C.elegans RNAi F from the Source BioScience library, forward 5′ ggagaccggcagatctgata, and reverse 5′ ggcctcttcgctattacgc.