Sentence examples for restrictions received from inspiring English sources

All 946 patients in the group mobilized with restrictions received a size 28 femoral head, while most patients (890 of 1,329) who were mobilized without restrictions received a size 36 femoral head (Table 1).

SRs that reported language restriction received significantly lower AMSTAR scores (mean =5.25, SD =2.32) (P<0.001).

Rats subjected to caloric restriction received also their prediet average, but of a calorically reduced, fibre-rich diet (AltrominR 1344/1500; 1,550 cal/g).

His adoption restrictions have received some attention, but it has been largely limited to people involved in international adoptions.

In January 2002, the commission sought public comments about further restrictions and received more than 64,000 written responses, with a majority supporting the creation of a do-not-call registry.

A control group of users were not subject to restrictions and received no guidance.

Starting at 48 h of feed restriction, cows received 9 hourly abomasal infusions of 0, 6, or 10 mg of NA/kg of BW.

Caloric restriction mice received a diet that was 10% less than CL in week 1, 25% less in week 2, and 40% less from week 3 10.

Polymerase chain reaction (PCR) was carried out on "Hybaid" amplificator (HBPX 220, Great Britain) with specific primers (F - CGCCCAATACCGCCAACAC and R - 3 CCACCAGGAGTCCCATCACC) and subsequent restriction of received PCR products by «BstOI» enzyme («Promega», USA).

Some states have moved to tighten restrictions after receiving complaints.

With the end of the Bush restrictions, scientists receiving federal money will be able to work with hundreds of stem cell lines that have since been created — and many more that will be created in the future.