Sentence examples for restriction regions from inspiring English sources

Most of them aimed at identifying single nucleotide polymorphism (SNP) in restriction regions.

Moreover, the related articles function was also used to broaden the search, and all studies, abstracts were reviewed without restriction to regions, publication types, or languages.

There was no restriction to regions or languages.

Two selected promoters (p37, and p55) (table 3) were amplified from an existing promoter library [ 3] by PCR with primers Fw-EcoRI-p37/Rv-BamHI-p37 Fw-EcoRI-p37/Rv-BamHI-p37 Fw-EcoRI-p37/Rv-BamHI-p37 Fw-EcoRI-p37/Rv-BamHI-p37 Fw-EcoRI-p37/Rv-BamHI-p37(tande Fw-EcoRI-p55/Rv-BamHI-p55 Fw-EcoRI-p55/Rv-BamHI-p55 Fw-EcoRI-p55/Rv-BamHI-p55 Fw-EcoRI-p55/Rv-BamHI-p55 Fw-EcoRI-p55/Rv-BamHI-p55

The antibiotic resistance genes (for chloramphenicol or kanamycin resistance) flanked with FRT sites were amplified by PCR with primers (Fw-EcoRI-P1/Rv-HindIII-P2) carrying the restriction site regions (EcoRI and HindIII) and priming sites from pKD3 and pKD4, respectively.

This demonstrated that the restriction free region next to the cDNA cloning site fulfills its function in repressing misleading fragments and the corresponding signals.

Even so, the compromise "definitely constitutes the toughest fisheries management restrictions this region has ever seen," said Dr. Anthony Chatwin, a marine scientist with the Conservation Law Foundation.

Mr. Sinclair said that such plans would allow him to tailor restrictions by region and on a case-by-case basis.

To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

It is shown that freezing of coarse grid source terms including spatial derivatives and restriction damping in regions of high chemical activity may remedy this problem.

The aim of this paper is to analyze how the restriction to convex regions constrains the realizability of networks of RCC8 relations.