Sentence examples for restriction of received from inspiring English sources

Exact(1)

Polymerase chain reaction (PCR) was carried out on "Hybaid" amplificator (HBPX 220, Great Britain) with specific primers (F - CGCCCAATACCGCCAACAC and R - 3 CCACCAGGAGTCCCATCACC) and subsequent restriction of received PCR products by «BstOI» enzyme («Promega», USA).

Similar(55)

Taiwan has been limited by several factors in its pursuit of energy transitions and rapid development of green energy, including goals of achieving a nuclear-free homeland, reducing air pollution, and restrictions on receiving capacity of liquefied natural gas reception terminals.

"My point is if you put a restriction [on receiving IVF treatment] of 45 or 50 years, you will have to put a restriction on the males also.

Starting at 48 h of feed restriction, cows received 9 hourly abomasal infusions of 0, 6, or 10 mg of NA/kg of BW.

A reward contrast effect might also account for the delayed appearance and lower magnitude of food anticipatory wheel running in Experiment 1 (Group 1) mice during their second food restriction schedule, after 4 weeks of receiving a palatable snack at that time of day.

Because of the fluid restriction, the patient received dopamine infusion at the intensive care unit, where blood pressure increased to 100/60 mmHg.

A control group of users were not subject to restrictions and received no guidance.

Control (normally fed, receiving daily i.p. vehicle), 2. Caloric restriction (fed with 70% of their normal food intake, receiving daily i.p. vehicle), 3. GF (normally fed, receiving daily i.p. 20 mg/kg of GF), and 4. GF + caloric restriction (calorie-restricted mice receiving daily i.p. 10 mg/kg of GF).

All 946 patients in the group mobilized with restrictions received a size 28 femoral head, while most patients (890 of 1,329) who were mobilized without restrictions received a size 36 femoral head (Table 1).

With the end of the Bush restrictions, scientists receiving federal money will be able to work with hundreds of stem cell lines that have since been created — and many more that will be created in the future.

Reports of restriction of freedom and compulsion to receive treatment by participants who had been detained confirm this association between compulsory admission and experience of coercion reported by other authors [ 54, 55].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: