Sentence examples for restricted templates from inspiring English sources

The 5,5-bicycles cis-6-oxo-hexahydro-2-oxa-1,4-diazapentalene 3 and cis-6-oxo-hexahydropyrrolo[3,2-c]pyrazole 4 were designed as rotationally restricted templates towards the preparation of inhibitors of CAC1 cysteinyl proteinases.

Lists can be used to restrict template queries to search for results relevant to that list.

Exponential WHOPS mutagenesis takes advantage of the DpnI restriction enzyme to restrict methylated template DNA.

Firstly, forward primer Term_F (gctcgaaggctttaatttg) and reverse primer Ku70_EXT_R (ctggacatcaagcttcggat) yield a 1.8 kb product which is restricted to gDNA templates where the Δku70 G418 locus has been replaced with a pCCKH over-expression cassette.

The covenants, which act as a template, restricted the C.D.O.

Monotonicity features of the MLG ensure that particles close in physical space are stored in adjacent array locations so that particle interactions may be restricted to a "template" of near neighbors.

For upstream walking using inverse PCR, the genomic template restricted with both KpnI and EcoRI produced amplicons that aligned with the genomic PKS assembly.

The 'core' is initially restricted to the template residues buried in the middle layer of the membrane.

The principal interactions between the clamp loader and double helix are restricted to the template strand [ 55, 60].

This tailor is Soho's Mark Powell, whose bespoke and ready-to-wear ranges are by no means restricted to the 60s template, though where he mixes Ivy and Italian with Savile Row he has attracted not only the custom of Weller and Wiggins but also mod-mad actor Martin Freeman, who favours Powell's serious seersucker three-pieces and tab collar/knitted tie combos.

Especially agencies love this, as they can create really compelling experiences and are not restricted by any existing template system".