Sentence examples for respectively fused from inspiring English sources

The assay comprises the co-cultivation of virus-infected target cells with immune IgG antibodies and mouse BW5147 hybridoma cells stably expressing chimeric FcγR CD3ζ chain molecules consisting of the extracellular domain of human FcγRIIIA, FcγRIIA or FcγRI, respectively, fused to the transmembrane and intracellular domains of the mouse CD3ζ chain.

These transgenes, pZ310 and pZ475, contain ZAM fragments extending from nucleotides 1 to 310 or 1 to 475, respectively, fused to the LacZ reporter gene.

For this, bioluminescence resonance energy transfer (BRET) experiments [9], [14], [15] were performed using V2 chimeric receptors and β-arrestins respectively fused to the luciferase from Renilla reniformis (Rluc) and the yellow fluorescent protein (YFP) (Figure 2a).

The plasmids pOU82- ftsZ and pOU82- fabH contain the ftsZ or fabH gene, respectively, fused to a constitutive E. coli promoter (ttgacagctagctcagtcctagg tactgtgcta) designed by John Anderson (IGEM2006_Berkeley).

The original VEGF-trap (Holash et al, 2002) is composed of IgG-like domains 2 and 3 of VEGF-R1 and VEGF-R2, respectively, fused to the constant region (Fc) of immunoglobulin IgG1 (Fig  1A and Supplementary Fig S1A).

The putative interaction proteins are respectively fused to two complementary fragments of one fluorescent protein, and then interaction of the proteins can reinvoke the fluorescence [ 46, 86], in a technique which is analogous to yeast two-hybrid assays (Fig.  6a).

Through searching for the proper fusion algorithm to respectively fuse the high-frequency component and low-frequency component from the wavelet decomposition and having the inverse transformation of wavelet, the fused images could retain the respective information of the original images effectively and efficiently, could even strengthen the minutiae of the original images [12, 13].

Furthermore, ORFs of ILV2, ILV5, ILV3 and truncated variants of ILV2, ILV5 and ILV3 of CEN.PK2-1C were also cloned by recombination cloning into the vector p423H7, p426H7 and pRS42KH7, respectively, fusing six histidine codons at their 3'-terminal ends.

The human PH1 Fab targeted against the MUC1 TAA was used to develop a human bivalent bibody and trivalent tribody by respectively fusing one or two PH1 scFvs to the C-terminus of the Fab chains.

Finally, the putative sorting motif together with a 123-amino-acid spacer derived from YhcR and YfkN designated YhcR123 and YfkN123, respectively, were fused to an α-amylase reporter enzyme.

Figure 12 shows the difference between the FVS view and the Resources view displaying respectively a fused analysis and a kernel analysis coming from the same set of traces.