Sentence examples for represents a restriction from inspiring English sources

The polymorphism located at the position −211 from FSHB mRNA start site (rs10835638) represents a restriction fragment length polymorphism.

Otherwise, e i represents a restriction related to the natural posture of the limb, and therefore e i ∈ Rdim⁡(d i ), where i ∈ [0, s], and Nee = p + s + 2. Notice that, due to modeling inaccuracies of the kinematic chains or the constraints, it is possible that for a configuration q R t some constraints cannot be satisfied within the desired tolerance.

According to Islamic law, the prophet himself, along with many of his close relatives, cannot be visually represented -- a restriction that has given rise to a great tradition of abstract motifs in Islamic art, but that would seem ill suited to traditional Disney-style animation.

After national court proceedings, the Court of Justice of the European Union (ECJ) finally ruled that the blockade represented a restriction on freedom to provide services under Article 49EC.

These findings suggest that DGAT may represent a restriction point in seed oil formation.

The primer used were 5'-CATCATaccggt ATGGACTACAAAGACGATGACGATAAA ATGAATTTGCAACTGGTT TCCTGGATTGGA-3' (small letters represent a restriction site for AgeI and underlined letters represent FLAG sequence) and ATGATG ACTAGTTCATTTTCCCTCATACTTCGGATTGACCAC (bold letters represent a restriction site for SpeI).

The IFITMs thus represent a restriction factor family of growing translational importance that protects the host at the earliest stages of infection (Diamond and Farzan, 2013; Perreira et al., 2013).

Wild type CD98 h, mutant CD98 (ΔCD98hc-β geo) and mutant CD98hc without β geo fusion (ΔCD98hc) were PCR amplified using the common forward primer 5'-CATCATaccggtATGAGCCAGGACACCGAAGTGGACA-3' (small letters represent a restriction site for AgeI).

Spirometry is very effective at excluding a restrictive defect, but a classic restrictive pattern on spirometry does not accurately predict a true restrictive defect because it represents a true restriction in less than 60% of cases (38).

It represents a further restriction on their businesses, which are already drawing criticism in some states that have restricted teenagers' access to tanning beds.

While for T = R this assumption becomes trivial, for discrete time scales (i.e. time scales with a nonzero graininess) it represents a considerable restriction.