Sentence examples for representation removes from inspiring English sources

Our representation removes this apparent uncertainty in the phonemic analysis of Chinese.

Also, the encapsulation of unexpected symbols within the primary representation removes the need for a wildcard elimination phase and storage of wildcard data in a secondary structure.

For instance the sequence TAAGACCTATGTTAGTAAAG would be represented as shown in table 2. This numerical representation removes any content bias of the original genomic sequences which may be an advantage or not depending on its intended applications [ 18, 36].

The mean color seems to be a suboptimal representation that removes too much information about the color distribution in the segments.

In this study, we propose a set of computational photography techniques based on sparse signal representation to remove optical aberrations, thereby allowing the recovery of images captured through a single-lens camera.

As the scope of the taxonomy became clearer through these consultations and diagrammatic representation, we removed various categories and intervention types that did not involve communication with parents and communities.

Instead, he thinks we begin with an empirical representation of space, remove the confused elements of that representation, and thereby obtain a clear and distinct idea, i.e., a conceptual representation of an abstract mathematical entity.[20] This discussion is reminiscent of Kant's fundamental disagreement with the Leibnizians regarding what Kant calls "sensibility" and "understanding".

After the generation of Representations, adaptors were removed from the Representations by digestion, followed by spin-column purification (Purelink PCR Micro Kit, Invitrogen, Carlsbad, CA, USA).

The "fixed fee" system, passed by the Labour government, drastically cut the amount of money prison lawyers can claim, effectively removing representation from many prisoners.

"Removing representation from my paintings wasn't really deliberate, I was just painting.

Blurred to the point of near anonymity, these images are poetic representations of how institutionalization forcibly removes individual identity by amassing offenders into a singular and heavily disdained mass.