Sentence examples for represent restriction from inspiring English sources

These suffered a decline toward the end of the 18th century because limitation of interest was thought to represent restriction, and the use of public funds seemed to stand for state monopoly.

Briefly, the 5' region of MjTyrRS was amplified using PCR with the primers, EYRS1-topBamH1, (bold letters represent restriction sites) (5'-AAGGATCCACCATGGACGAATTTGAAATGAT-3') and EYRS1-bot (5'-ACATTCATATTGCCGAACCACTGGAATTCACTTCCAT-3').

Nucleotides in bold represent restriction enzyme cutting sites.

For each primer the regions in bold represent restriction sites used for cloning.

Enzymes represent restriction enzymes for detection of each RFLP of PCR product.

The underlined sequences represent restriction sites for BamHI and SalI, respectively.

If the myriad restrictions on clinical research were justified on the basis of hard paternalism they would represent restrictions on individuals' autonomous actions.

We were able to identify a single-nucleotide polymorphism in leader exon 1C representing restriction fragment length polymorphism.

The first step to construct a physical map is generation of fingerprints representing restriction digests of BAC DNA using efficient techniques [ 20, 27].

This approach might present some problems, like possible conflicts between rules, and limitations for representing restrictions on system configurations.

The primer used were 5'-CATCATaccggt ATGGACTACAAAGACGATGACGATAAA ATGAATTTGCAACTGGTT TCCTGGATTGGA-3' (small letters represent a restriction site for AgeI and underlined letters represent FLAG sequence) and ATGATG ACTAGTTCATTTTCCCTCATACTTCGGATTGACCAC (bold letters represent a restriction site for SpeI).