Sentence examples for reported description from inspiring English sources

Al Jazeera — not Lehrer — is what the internationally minded elite class really yearns for: a visually stunning, deeply reported description of developments in dozens upon dozens of countries simultaneously.

A comparative analysis of the piezo-voltage dependence on the compressive strain, obtained from a previously reported description of the nanoribbon dynamics and from the more accurate molecular dynamics, reveals that the method here presented gives a more precise description of the effect of in-plane vibration of the atoms on the harvesting performance of the device.

Given the previously reported description of CMY-16 in P. mirabilis from northern Italy [ 21], P. mirabilis clinical isolates were also screened for the presence of the blaCMY-16 gene, using specific primers CMY-Exp_Fw GCTCTAGACATATGATGAAAAAATCGTTATGCTG CMY-Exp_Rev CGGGATCCTTATTGCAGCTTTTCAAGAATG (1165 bp amplicon size).

When asked to describe present-day Christianity, the second most reported description of young people (ages 16 to 29) was that it is "too-judgmental," with 87percentt of young non-churchgoers and 52percentt of churchgoers holding this view.

Asked about a senior official's reported description of North Korea behaving "like a spoiled child", Hong replied: "China takes note of the leaked reports.

This result is consistent with the reported description of CDH as a nuclear-localised protein in migratory and post-migratory PGCs [39].

Asked if it included monkey chants, the Fare chief executive, Piara Powar, said: "Our observer reported descriptions of that nature.

Clearly, Beethoven had a more hopeless affliction – possibly nerve damage and certainly roaring tinnitus – but his reported descriptions of distortion and frequency loss now sound horribly familiar to me.

On Tuesday, the BBC's Lyse Doucet, on her Twitter account @bbclysedoucet and the BBC's website, reported descriptions and quotes from the migration of civilians she interviewed near the entrance to the suburb.

Asked if it included monkey chants, Fare chief executive Piara Powar said: "Our observer reported descriptions of that nature.

The clinical characteristics of most cases of OROV fever in this outbreak were similar to previously reported descriptions of the illness.