Sentence examples for replacement constructed from inspiring English sources

Exact(1)

Its replacement, constructed by Roger Bigod, the Earl of Norfolk, was unusual for the time in having no central keep, but instead using a curtain wall with thirteen mural towers to defend the centre of the castle.

Similar(57)

For Dictyostelium discoideum cells, the gene replacement construct typically consists of a Blasticidin S resistance (Bsr) cassette flanked by fragments of the target gene to allow insertion by homologous recombination.

This change in ploidy has occurred during the introduction of the second replacement construct.

Unlike cross-validation, which uses sampling without replacement for constructing test and training data sets, 0.632 bootstrapping employs sampling with replacement, constructing the training set from data sampled with replacement and the test set from the remaining data that weren't sampled.

The P. berghei LplA1 gene locus was not only targeted by a knock-in construct but also by the gene replacement construct, which exchanges the PbLplA1 gene with the selectable marker and consequently deletes the PbLplA1 gene.

fimL-GFP was subcloned from pYFI007 into PJB100T by overlap PCR with a PCR fragment downstream of fimL on the PAO1 chromosome and was amplified using primers 5' CGGCATGGACGAGCTGTACAAGTAATGGCCGGCGAGTTCCGCTGGC and 5'CAGGGTAATACTAGTAGCGGCGCGCCAGGTAC to generate the fimL-GFP gene replacement construct pYFI043.

Parasites transfected with the replacement construct b3D-LplA1-REP were analysed using the gene locus specific primer set Pb-3/Pb-11 (amplifying a 1837 bp product) or Pb-10/Pb-12 Pb-10/Pb-12 Pb-10/Pb-12roduct).

The P. berghei LplA1 gene locus is targetable by knock-in and also a gene replacement construct, clearly demonstrating that this gene locus is not refractory to recombination in P. berghei.

Details of primers used to generate double-cross over replacement constructs (i.e. to introduce 'targeting regions' in the replacement construct pL0001; (See MR4 [ 66] and also Additional file 3 Figure S1 and Additional file 5 Table S3).

A gene replacement construct for disruption of umxyn11A (um06350) was constructed by a reverse genetic approach described by Brachmann et al. [ 39].

The flanks and the hygromycin resistance cassette were digested with SfiI (indicated by italic sequences) and ligated to obtain the complete replacement construct.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: