Exact(1)
Additional searches for repeats and inverted repeats were performed using GENETYX soft ware (Version 8; SDC, Tokyo, Japan).
Similar(59)
Lower-case masking of simple and complex repeats was performed using Tandem Repeat Finder [ 52] and RepeatMasker [ 53], respectively.
Statistical analysis of survival curves (pooled data from three independent experimental repeats) was performed using Mantel-Cox log-rank test.
Bayesian inference of the phylogenetic relationships between the RlX, Rsp-like and canonical Rsp repeats was performed using MrBayes [ 74] using a GTR nucleotide substitution model with Gamma rate variation.
BSS analysis of 59 CpGs in the DUX4 promoter region (DUX4 5′ BSS assay) of 4q and 10q D4Z4 repeats was performed using primers BSS167F: TTTTGGGTTGGGTGGAGATTTT and BSS1036R: AACACCRTACCRAACTTACACCCTT, then followed by nested PCR with BSS475F: TTAGGAGGGAGGGAGGGAGGTAG and BSS1036R using 10% of the first PCR product.
Mixed-model analyses for repeated measures were performed using the baseline scores as reference.
The repeat analyses were performed using a 2-fold dilution of the sample and the measured concentration was doubled to account for the dilution.
All repeat analyses were performed using both Censor [ 24] and Repeatmasker.
Repeat conjugations were performed using initial molar ratios of 20, 40 and 60 and the conjugates were purified as before.
Comparisons between stimulus-evoked neuronal responses and spontaneous firing over repeated trials were performed using t-tests.
When the specimens were not sufficient to establish the diagnosis, repeat biopsies were performed using the same technique as the first.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com