Exact(30)
To reiterate, by combining pneumatic piston/switch pairs into a larger circuit, a pneumatic timing/feedback circuit can be created that repeats sequences of patterns.
Results from a previous study provided information about the evolution of A. marginale strains using MSP1a repeats sequences [4], corroborated its genetic heterogeneity at a global scale and suggested a tick-pathogen co-evolution.
Individual spacers were removed from the sequences by manually extracting the sequence between the repeats sequences: A repeat is GATAATCTACTATAGAATTGAAAG and C repeat is GATTAATCCTAAAAGGAATTGAAAG. Spacers were grouped according to the ends of the loci they came from, and BLASTn [48] with E<0.001 was used to find 100% spacer matches.
These three steps were repeated for every sequence in the database of annotated Alu repeats sequences.
We have proposed a method of restriction analysis of Alu repeats sequences in silico.
We have made some additions to 5'-truncated short Alu repeats sequences to unify them for a subsequent analysis.
Similar(30)
Microsatellites (microsats) are long tracts of non-coding repetitive DNA comprised of short tandem repeating sequences.
The repeated sequences delight children as they can anticipate Goldilocks audacity and revel in the mounting disapproval.
It includes adult language, repeated sequences of brilliantly staged action and brutality, and, oh, yes, alcohol consumption.
She also made her dance formally ingenious, for before it ended she repeated sequences she had introduced at the beginning.
The dancers strip to their underwear on chairs in fast repeated sequences that suggest a protest against conformity.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com