Sentence examples for repeating consensus from inspiring English sources

This protein contains eight repeating consensus sequences, each of which consists of 24 amino acid residues and exhibits a periodic pattern in the occurrence of leucine, proline, and asparagines.

First, for each strategy A, B, C, we compute the best case and worst-case execution time of k instances of repeated consensus, based on two parameters α and β: The parameter α is the one used in Algorithm 5.

Moreover, during the study, repeated consensus meetings were held at regular intervals.

After repeated consensus discussions, the classification was finalized when all classifications were agreed upon.

Because of the repeated consensus motif at both splice junctions, IRE1 cleavage and exon exon ligation restores this sequence element.

Conversely, the percent identity between the non-rDNA array short repeat consensus and the rDNA array consensus was not improved by deRIP (Table 2).

However, quite a big difference in DNA structures between all subfamilies makes difficult a presentation of general Alu repeats consensus sequence covering all subfamilies and there is no such a sequence in Alu repeats database [ 10].

The answer to this lies in a closer inspection of the repeated consensus sequences in table 1. Let's take sequence TAAGACCTATGTTAGTAAAG for chromosome 6 which has a double cytosine.

We hypothesized that the actual number of the repeated consensuses in the cognate allele would determine the secondary structure of the corresponding SLC6A3 transcript.

To confirm results, we additionally used two Alu repeat consensus sequences.

We built a multiple alignment at the level of single repeats to define the EPTP repeat consensus sequence (Figure 5).