Your English writing platform
Discover LudwigExact(1)
The requirements for effective tag sequences are (i) sequence length appropriate for higher duplex stability but smaller tag size for synthesis of compact repeated tags; (ii) no formation of higher-ordered structures; (iii) no interference to the sequence, structure, and function of RNA main parts; and (iv) avoidance of self-dimerization of complementary ECHO probes.
Similar(59)
On July 22 a graffiti artist and onetime protégé of Haring's seriously altered it by filling in the negative space with an intricate black interlocking pattern and spray-painting it with the repeated tag LA II.
In this paper, we argue that CRB may work more poorly than other protocols which do not consider the repeated tag identification, such as query tree (QT) and collision tree (CT) protocol, when only few tags stay.
Repeated tag sequences produce cell images with sharper fluorescence.
A plasmid vector containing a fluorescent protein-coding region and a 64-time repeated tag sequence was synthesized as follows.
In addition, because a fluorescent nucleotide is usually incorporated into the center part of the probe, interference between the fluorescent dyes of probes is avoided even if the probes are arranged tandemly onto the repeated tag sequences.
As an example, an HcRed1-coding region was amplified from pHcRed1 (Clontech) by PCR using primers containing four-time repeated Tag(gau) sequences and XhoI, SalI, and EcoRI restriction sites (forward, 5'-AAAAAGCAGGCTTCGAAGGAGATAGAACCATGGTGAGCGGCC-3'; reverse, 5'-AGAAAGCTGGGTGAATTCAGAGGTCGACCTTATTCTCAATCCAATCCTTATTCTCAATCCAATCCTTATTCTCAATCCAATCCTTATTCTCAATCCAATCCTCGAGTCAGTTGGCCTTCTCGGG-3').
The repeated tag sequence is attached to a sequence end part, e.g., 3'-untranslated region (UTR) of the target RNA, which has a minor influence on the RNA structures and functions.
Genes with repeated locus tags were removed from the analysis, for a final total of 4428 genes with locus tags in MG1655.
Type IV crRNAs were shown to harbour unusually short 7 nucleotide 5′-repeat tags and stable 3′ hairpin structures.
Repeat tags: Repeat Every Monday Every year Every Tuesday and Wednesday Every week Every two weeks Every month Every six months.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com