Sentence examples for repeated a third time from inspiring English sources

These mistakes should not be repeated a third time.

The boys were then begun on daily subcutaneous (SC) GH (0.3 mg/kg/wk), while T therapy was continued for another 4 weeks and the studies repeated a third time.

Based on that it plays three more samples, from which the customer chooses the best and then the process is repeated a third time.

This procedure was repeated a third time with primer (F: TTGCCAACGTGAACAGCAAC) to determine the open reading frame (ORF) of the gene.

The cycle repeated a third time.

Here, as in many of Schubert's sonata form movements, a repeat sign is written for an exceedingly long exposition, while the material of the exposition is repeated a third time in the recapitulation with little alteration.

The process is repeated a second time, then a third.

This whole process is repeated a second time and applied to mid-classified and misclassified pixels separately.

The experiment was repeated a second time, with foals receiving a different diet so that every diet was tested 4 times on a different animal.

The manoeuvre was repeated a second time 10 days later after the sinking of the General Belgrano and the successful Argentinian attack on HMS Sheffield.

The supernatant was removed by centrifugation, and the same treatment was repeated a second time.