Your English writing platform
Discover LudwigExact(4)
In case of positive HPV testing or persisting ASC-US/LSIL at 12 months, a repeat control is necessary at 18 months and a treatment is proposed according to colposcopy findings.
A woman will be referred for colposcopy if two ensuing repeat control tests show persistent equivocal or low-grade lesions.
A standard curve for the Alu repeat control reaction was generated from 1 25 serial dilutions of bisulfite-converted, M. SssI-treated DNA for the methylated MethyLight reactions.
Sense and anti-sense oligonucleotides (A10, (CA 26, G10 and N26 = GCGCTTATACTAAGCGGAAATCGTTA as non-DNA repeat control) with a 5′-CGCG overhang to create a compatible site for the linearized pIREShyg2-EGFP were annealed and directionally cloned into the PmeI– AscI site of pIREShyg2-EGFP to generate the plasmids pIREShyg2-EGFP- oligonucleotide).
Similar(56)
Perhaps the cruciform structure formed by the inverted repeat controls transcriptional regulation of the paralogs.
Since then, repeated control efforts failed and some 100 million gallons of crude poured into the gulf.
A series of tandem DNA repeats control methylation of the adjacent DMD, which is a methylation sensitive enhancer-blocking element.
Since the WD-repeats control recognition specificity, we assessed the possibility that they might be under positive Darwinian selection.
N26 is a random DNA sequence which served as non-repeat control (5′-GCGCTTATACTAAGCGGAAATCGTTA-3′).
This requires surveillance and forceful and repeated control campaigns.
Repeated control samples were set in every genotyping plate, and the concordance was >99%%.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com