Exact(6)
One officer painstakingly repeats to another instructions to remove the expression "nerve agents" from "the wireless instructions," which Mr. Powell said he interpreted to mean as "don't give any evidence that we have these horrible agents".
"Remove the expression 'nerve agents,' " ordered one official who forgot that the purpose of his call was to conceal those words from our Big Ear, "in the wireless instructions".
"The Communist Party of China Central Committee proposed to remove the expression that the President and Vice-President of the People's Republic of China "shall serve no more than two consecutive terms" from the country's Constitution," the text released by the party says, according to a translation by the state-run Xinhua news agency.
To remove the expression dependence of T7 RNA polymerase of the pET28-FtsZ-mEos2 plasmid, the ftsZ-mEos2 fragment was amplified by PCR from the pET28-FtsZ-mEos2 plasmid using primers CTATGGCCCTGAGGGCCATGTTTGAACCAATGGAACTTACC and AATTGCGGCCGCTTATCGTCTGGCATTGTCAG.
These interruptions perhaps remove the expression of CREE-associated genes from ancestral neisserial regulatory networks.
To remove the expression tag, purified DHQD was incubated overnight at 4 °C with hexahistidine-tagged TEV protease and repurified by Ni-NTA chromatography.
Similar(54)
While the knock-out of Snrpn alone has no abnormal phenotype [14], a partial deletion of the PWS orthologous region, extending from Snrpn to Ube3a, removes the expression of the Snrpn coding transcript and of all the paternally expressed non-coding elements in between Snrpn and Ube3a [18].
We removed the expression data under perturbations of TATA binding protein (TBP), histone proteins (H3 and H4), proteins with unknown chromatin regulation activities, as well as comparative perturbations, because they do not represent perturbations of chromatin regulators.
We have now removed the expression "visual acuity" from the entire text and figures and changed it into "spatial frequency threshold of the optomotor reflex".
In N. meningitidis, a CREE has inserted within the regulatory region for mtrCDE and removed the expression of these genes from control by MtrR and MtrA [ 14].
We calculated the average and the standard deviation of the base 2 logarithm of the expression ratios of four spots and removed the expression ratios of genes whose standard deviation was >1.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com