Sentence examples for relative calculated from inspiring English sources

The difference of 11.3% between this re-estimate and the original suggests that interest bias may have led to overestimation by some 14% (relative, calculated as 11.3/79.6*100), which is a moderate influence.

(D ) Relative permeabilities calculated from the Goldman-Hodgkin-Katz equation.

Relative Expression changes are calculated relative to B2M (B2Ms: TGCTGTCTCCATGTTTGATGT ATCT and B2Mas: TCTCTGCTCCCCACCTCTAAGT).

Relative mRNA was calculated using a relative ratio to Gapdh.

Relative percentage enrichment was calculated as relative bound activity adjusted for relative input activity.

Relative quantities were calculated from the appropriate relative standard curve.

Relative quantification was calculated using comparative threshold cycle method (ΔΔCT).

Relative expression was calculated using comparative Ct values.

Relative quantitation was calculated using delta cycle threshold relative quantitation.

Relative expression was calculated using the comparative Ct method (2−ΔΔCt) [47].

Relative risk was calculated by Cox proportional modeling.