Sentence examples for reference forward from inspiring English sources

Lila, the beautiful girl whom the provincial kid stumbles upon in the woods as a boy and can't ever forget, is a reference back to the princess in Alain-Fournier's "Le Grand Meaulnes," while her trimmed hair is a reference forward to the signature coiffure of Jean Seberg herself.

The Reference Forward Model (RFM) is a general purpose line-by-line radiative transfer model, currently supported by the UK National Centre for Earth Observation.

The P. xylostella ribosomal protein gene L32 was used as the housekeeping reference (forward primer: 5′-AAT CAG GCC AAT TTA CCG C-3′; reverse primer: 5′-CTG GGT TTA CGC CAG TTA CG-3′).

Glyceraldehyde 3 phosphate dehydrogenase (GAPDH) was amplified as internal reference – forward primer (5′-AGCCACATCGCTCAGACACC-3′), reversed primer (5′-GTACTCAGCGCCAGCATCG-3′), 57 °C annealing temperature, 30 s elongation time, 25 cycles.

At heterozygous positions sequenced bidirectionally, the minimum number of original template molecules required to produce a signal is only four: forward reference, forward alternate, reverse reference, and reverse alternate.

We determined our optimal real-time concentrations for target and endogenous reference forward and reverse primers using the standard grid testing method as suggested by ABI (see "Additional Details Regarding Optimizing Real-Time Primers and Fluorogenic Probes Before their use with Experimental Samples: Optimization and validation tests performed on cDNA" section below for more details).

Out of the box, they have included three reference forwarding agents: Facebook Open Switch System (FBOSS) from Facebook, L3 Routing from NTT and OpenFlow from Big Switch Networks.

With reference to forward scattering, the model performance seems poorer and more item-dependent.

All of this is by way of saying, we appreciate the Europe reference — looking forward to seeing what you can do next time with Asia! (No, seriously. It's a challenge).

GAPDH was selected as the reference gene (forward; 5′ GCACCGTCAAGGCTGAGAAC 3′, reverse; 5′ TGGTGAAGACGCCAGTGGA3′).

The systematic review made use of electronic database searching, reference screening, forward citation tracking and expert consultation.