Sentence examples for recovered separately from from inspiring English sources

Over the next fortnight, her arms and legs were recovered separately from the water.

One tooth, however, an incomplete crown recovered separately from the other six loose teeth, does preserve what appear to be wear features on the presumed labial surface some distance from the apex.

Both the larger band (~0.9 kb) and the wild type size band (0.77 kb) were recovered separately from the gel using the QIAGEN gel extraction kit, and subjected to automated sequencing with primers PrPO-F, PrPO-R, and HP306R (CATGTTGGTTTTTGGCTTAC TC).

The recombinant proteins expressed from pET-28a-ORF3 and pGEX-4 T-ORF5 were recovered separately and subjected to SDS-PAGE.

Cell-free supernatants and cells were separately recovered from each sample of untreated or treated cells 24 h after the addition of the various compounds.

To determine the basal and inducible release of IL-6 and CCL5 in culture, LNCaP cells and the corresponding cell-free supernatants were separately recovered from each treated or untreated cell culture.

The sequences recovered from Tabasco sauce tended to cluster separately from those recovered from patients (Figure 3a).

For each region, the time to the most recent common ancestor (TMRCA) recovered from different outbreaks was separately estimated (Table 5).

(d) Recovered image from (c).

Comninos recovered safely from his injury.

Brands have recovered from worse.