Sentence examples for recombinants forward from inspiring English sources

Suggestions(1)

Exact(1)

To investigate whether the putative recombinants were true or PCR artifacts we designed PCR primers which amplify wFex1-wFex4 recombinants (forward: 5'-GGTATTGCACATAAATCAGGCA-3' and reverse 5'-AAACTGCATGTCCTCCTTTATC-3') and wFex4-wFex1 recombinants (forward 5'-GGGACTGATGATGTTGATCCT-3' and reverse 5'-TTGAGTTCCCCTTTGCCGTC-3').

Similar(59)

As concluded by Silver and colleagues, larger studies are required to take the investigation of the use of recombinant erythropoietin forward in this patient population.

The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments.

Primers used for the mutagenesis of recombinant DISC1/ DISchimericmeric transcripts: forward 5-AAATGCATGC AATTAGCTAATAAGGCACCACCGATCGTAGTCTG, reverse 5-CAGACTACGATCGGTGGTGCCTTATTAGCTA ATTGCATGCATTT.

From the four plating done for each SSH cDNA library, 492 recombinant colonies for the forward and 502 colonies for the reverse library could be picked-up.

The extinction coefficient of NADH at 340 nm (6220/M/cm) was used to calculate the specific activity of recombinant PfaE3 in the forward and reverse reactions.

As determined by band intensity values, the percentages of recombinants in the M13-Forward primer orientation were around 88%and68%8% for TA ligated 60S-L37 and 40S-L17; while in case of cohesive ligations, they were around 73%and71%1%, respectively.

For minigene recombinants two primers were used: (Forward: CAAACCCACCCGCTTTTTAT; Reverse: TACGTTGAAATGTCCCATCG).

Recombinant HlBCAT1 and HlBCAT2 catalyzed forward (biosynthetic) and reverse (catabolic) reactions with similar kinetic parameters.

The 3D structure of the NAT enzymes needed sufficient pure protein for crystallization and recombinant protein was the way forward.

Clones were tested by PCR, using M13 reverse and forward primers, and recombinant plasmids were sequenced from both strands by GATC Biotech (Konstanz, Germany).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: