Your English writing platform
Discover LudwigExact(6)
Caspases recognize a sequence of four residues C terminus from the scissile bond, identified as P4 to P1, where P1 position corresponds to an aspartate residue in most substrates5,46 and the residue in P4 provides some specificity among caspases.
Since the purpose of the CHEMDNER task is to recognize a sequence of words with various lengths that specify a chemical entity, the distribution of entity name lengths in the corpus after tokenization serves as an essential factor in determining the selection of tag scheme.
In the few studied cases, the restriction enzyme uses a flipping mechanism to recognize a sequence or adjust the shape of the DNA within its catalytic site for proper cleavage.
For each primer combination, one primer was designed to recognize a sequence region with a nucleotide insertion or deletion specific for a given gene copy, the second primer binding to an unspecific region of either TaSK1 or TaSK2.
Digest PCR product with a suitable restriction enzyme to remove bisulfite unconverted DNA, i.e. the enzyme should recognize a sequence with at least one dC which would be converted to dT by bisulfite treatment, conferring resistance to digestion.
The Rosa26 BAC was amplified with oligos RosaF 5' TCTTGTCCTTTTACCTCCCTTGTA RosaR 5' GAACATATTCAAAACACCAGGATTT. These oligos recognize a sequence that is identical in the Rosa26 BAC (from murine origin) and in the endogenous Rosa26 locus (HEK cells, from human origin).
Similar(54)
We tested this approach in an in vitro HSV latency model using the engineered homing endonuclease (HE) HSV1m5, which recognizes a sequence in the HSV-1 gene UL19, encoding the virion protein VP5.
When a restriction endonuclease recognizes a sequence, it snips through the DNA molecule by catalyzing the hydrolysis (splitting of a chemical bond by addition of a water molecule) of the bond between adjacent nucleotides.
Complexes 2 and 3 recognized a sequence in the left half of P2-89 ending in AACTTCC.
By using a forward primer recognizing a sequence at the end of exon 3 of PML and a reverse primer recognizing a sequence at the beginning of exon 9 we were able to examine the internal exon splice variants of the PML I transcript which is believed to be the predominant PML isoform [41].
Polyclonal antibodies were developed against these peptides; polyclonal antibody NMT-4 recognized a sequence in the amino terminal region of nmt55/p54nrb and polyclonal antibody NMT-5 recognized a sequence in a mid-region of nmt55/p54nrb.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com