Sentence examples for received pcr from inspiring English sources

Received PCR products were separated by electrophoresis in 2 % agarose gel (Sigma-Aldrich, Germany) stained with ethidium bromide (5 μg/1 ml; Syngen, USA).

Polymerase chain reaction (PCR) was carried out on "Hybaid" amplificator (HBPX 220, Great Britain) with specific primers (F - CGCCCAATACCGCCAACAC and R - 3 CCACCAGGAGTCCCATCACC) and subsequent restriction of received PCR products by «BstOI» enzyme («Promega», USA).

Parents/guardians for a total of 242 55%) HIV-exposed infants returned to receive PCR test results, including 51/75 (68%) of those PCR positive, 187/361 (52%) of the PCR negative, and 4/5 (80%) of those with indeterminate PCR results.

Essentially, patients with that mean daily cost or higher can receive PCR testing without incurring net cost.

Only a quarter of infants received a PCR test at 6 weeks.

Infants found to be HIV-infected received DNA PCR testing even later, at an average of almost 6 months of age.

In the epidemic setting, only a consecutive subset of the patients received a PCR test; however, this subset contains a considerable number of patients with a positive test.

In addition, within the group of luminal tumors Ki-67 values of patients with versus without pCR differed significantly: patients receiving a pCR presented with Ki-67 values of 50 ± 36.5% versus 18.1 ± 12.9% (P = 0.001) (Table 4).

While PCR testing improved across the entire District during the study period, ESD improved at a faster rate and the proportion of babies receiving HIV PCR tests was significantly higher in Eastern (96%) than in the rest of the city (86.7%) (1,558 tested of 1,629 exposed infants versus 9,451 tested of 10,896 exposed infants, Figure 3A., p< 0.001).

We observed an increase in the proportion of HIV-exposed infants receiving DNA PCR testing and earlier uptake of EID testing services over time.

Parents and guardians were given appointment cards and asked to return to the clinic 1 month after DBS collection to receive DNA PCR results and to refill cotrimoxazole prescriptions.