Sentence examples for rec a from inspiring English sources

UK/England: Oxfordshire REC A, National Research Ethics Service, NHS.

BAC: Bacterial Artificial Chromosome; Rec A: Recombinase A; FP: Fluorescent Protein; TRAP: Tartrate Resistant Acid Phosphatase; DMP1: Dentin Matrix Protein 1; IBSP: Integrin Binding Sialoprotein; ECFP: Enhanced Cyan Fluorescent Protein; KB: Kilobase; SP: Spectinomycin; GM: Gentamicin; AMP: Ampicillin; CHORI Childrenn's Hospital Oakland Research Institute; BP: Base Pair.

Soundsville FC had no home pitch and played at the Netham Rec, a few miles to the north.

And when the comedy NBC embraced that fall, "Outsourced," had its own issues with not blooming fast enough, NBC pulled it at midseason from the slot after "The Office" and gave "Parks and Rec" a shot there.

If you REC a song while it is still free (0 cents), and it ends up at 98 cents, we will deposit 98 cents into your Amie Account.

If you REC a song at 1 cent or above Amie Street will pay you half of the difference in the prices.

Of the members of the Rec-A/Rad51 family, Rec-A has been reported to be functioning in the chloroplast [ 59, 60].

The Bcc rec-A gene (1.040 bp) was amplified using the primers BCR1 (tgaccgccgagaagagcaa) and BCR2 (ctcttcttcgtccatcgcctc), respectively, for the target 5' and 3' ends of the rec-A gene locus.

Although diatoms lack DMC1 and HOP2 genes, they possess five to six homologs of RAD51 (either one or two homologs of RAD51-A, and one homolog each of RAD51-B, RAD51-C, XRCC3 and REC-A) and MCM8 and MCM9.

For RFLP analysis, the Bcc rec-A gene amplicons (up to 40 μl) were digested with MnlI (New England Biolabs, Inc) and HaeIII (New England Biolabs, Inc) restriction endonucleases in the appropriate buffers at 37°C for 2 h [ 14].

Cpm values were extracted for the transcripts belonging to the meiotic toolkit (excluding REC-A which is supposed to be chloroplastic) and normalized, after which a heatmap was constructed (Fig.  4).