Sentence examples similar to real time detector from inspiring English sources

Similar(60)

Furthermore, a new real-time detector employing additive synthesis is proposed.

The potential of a single PZT element is discussed as a real-time detector for hypervelocity microparticles.

Even though we have still unknown processes inherent in this detection method, the piezoelectric element has a potential as a real-time detector, if it is well calibrated.

A real-time detector system for neutron radiography based on CMOS camera has been designed for the thermal neutron imaging facility under construction at China Advanced Research Reactor CARRR).

All reactions were performed using the Chromo4 real-time detector (Bio-Rad).

The DNA Engine Thermal Cycler with Chromo 4™ real-time detector system and Opticon Monitor software (Bio-Rad Laboratories, USA) were used for real-time PCR analysis.

QRT-PCR reactions were performed using a chromo4 real-time detector (MJ Research) and standard protocols of 60°C annealing temperature.

Quantitative PCR was then performed using BioRad Chromo4 real-time detector in an 8 μl reaction [1 μM forward primer, 1 μM reverse primer, 1X Quantitect SYBR Green (Qiagen), and 5 ng cDNA].

Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using a Chromo4 real-time detector (Bio-Rad) and Brilliant III Ultra-Fast SYBR Green qRT-PCR (Agilent).

The 5′-3′ primer sequences were: B2m (F CCCCACTGAGACTGATACATACG and R CGATCCCAGTAGACGGTCTTG); Vim (F TGGTACAAGTCCAAGTTTGC and R CTCCGGTACTCGTTTGACT) and Ribosomal protein S29 (Rps29, F TCTACTGGAGTCACCCACGGAAGT and R TCAGTCGAATCCATTCAAGGTCGC). Reactions were run in a StepOnePlus™ real-time detector using the Fast SYBR® Green Master Mix (Applied Biosystems, Foster City, CA).

Using a 384-well format with the Prism7900HT real-time detector (ABI), 2 μl aliquots of (10×) QuantiTect Primer Assay (validated primers to the specific gene of interest; Qiagen), 10 μl (2×) QuantiTect SYBR PCR Master mix (Qiagen), and 8 μl cDNA were mixed together for 20 μl total reaction volume and pipetted into single wells of the 384 PCR plate.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: