ready to combine

USAGE SUMMARY

The phrase "ready to combine" is correct and usable in written English.
It can be used when indicating that two or more elements are prepared to be merged or integrated together. Example: "The ingredients are all prepped and ready to combine in the mixing bowl."

✓ Grammatically correct

News & Media

Wiki

Science

Academia

Human-verified examples from authoritative sources

Exact Expressions

7 human-written examples

Instead, he proposed an effort that would enlist all other groups ready to combine forces for such an emergency.

The New York Times

Or is it perhaps a tip-off that these two austere & scrappy groups...are at last ready to combine and fight side by side.

The New Yorker

I think being ready to combine both can help, not only with an initial success, but with the complicated moves needed to parlay it into a more enduring one.

Harvard University

The presence of Nanigans and Optimal in the Exchange program may indicate that when Facebook is ready to combine targeting options, it wants experienced Ads API partners ready to test it.

TechCrunch

I urge you to be ready to combine your wholesome work ethic (that has doubtless been the first inspiration for what are now literally thousands of single mothers) with a dash of your stepmother's poison..

Huffington Post

You are now ready to combine your ingredients and make your coffee.

WikiHow

Human-verified similar examples from authoritative sources

Similar Expressions

53 human-written examples

Furthermore, the 3′ part (TAGGGTTGGGCGGGATGGGT) of Gx DNA are exposed and ready to combined with hemin to form hemin/G-quadruplex DNAzyme, which could amplify the generation of chemiluminescence (CL) in the presence of luminol and H2O2.

Sensors and Actuators B: Chemical

3. When ready to serve, combine all ingredients for glaze in a bowl.

The New York Times - Food

Set aside to cool. 3. When ready to serve, combine the vinaigrette, shrimp, rice, scallions, basil and mint and toss.

The New York Times - Magazine

4 When you are ready to serve, combine the beetroot, their leaves and the leeks with the crumbled cheese and dill fronds.

The Guardian - Lifestyle

3. When almost ready to serve, combine the shrimp, red onion and tomato in a medium bowl and season with red wine vinegar and one-fourth teaspoon salt, or to taste.

Los Angeles Times

Expert writing Tips

Best practice

When describing a process, use "ready to combine" to clearly indicate the stage where different elements are prepared to be mixed or integrated. For instance, in cooking, it signals the point at which ingredients are prepped and awaiting combination.

Common error

Avoid using "ready to combine" in overly complex sentences where simpler verbs like "mix" or "integrate" would be more direct and effective. Clarity is crucial.

Linguistic Context

The phrase "ready to combine" functions as an adjective phrase modifying a noun, indicating that something is in a state of preparedness for combination. As Ludwig AI suggests, it implies a state where elements are prepared for merging or integration. Example: "The ingredients are all prepped and ready to combine in the mixing bowl."

Expression frequency: Uncommon

Frequent in

News & Media

29%

Wiki

21%

Science

18%

Less common in

Academia

9%

Formal & Business

0%

Reference

0%

Ludwig's WRAP-UP

In summary, the phrase "ready to combine" is grammatically correct and serves to denote preparedness for merging or integrating different elements. Ludwig AI validates the correctness of the phrase. It is used across varied contexts, particularly in news, wiki entries, and science but more frequently in neutral settings. Although not exceedingly common, its use is appropriate when describing a state of anticipation before a combination. Related phrases include "prepared to merge" and "set to unite". When writing, ensure that you are not overcomplicating your sentences by using it, opting for simpler verbs instead when possible.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

prepared to merge

Emphasizes the act of merging, suggesting a more formal integration.

set to unite

Highlights the joining of elements for a common purpose or goal.

poised to integrate

Suggests a state of readiness for a complex form of combination.

about to amalgamate

Indicates an imminent blending of different entities or substances.

on the verge of consolidating

Focuses on the nearing completion of a process to bring together.

geared up to incorporate

Implies preparation and intention for a structured combination.

primed for conjunction

More formal, highlighting the state of being prepared for a joining.

all set to converge

Focuses on the act of coming together from different directions or origins.

in a position to synthesize

Emphasizes creating a new, unified entity from different components.

ripe for fusion

Suggests optimal conditions for a complete and seamless blend.

FAQs

How can I use "ready to combine" in a sentence?

You can use "ready to combine" to indicate that different elements are prepared to be merged or integrated. For example, "The ingredients are all prepped and ready to combine in the mixing bowl."

What are some alternatives to "ready to combine"?

Some alternatives include "prepared to merge", "set to unite", or "poised to integrate", depending on the specific context.

Is "ready to combine" formal or informal?

The phrase "ready to combine" is neither strictly formal nor informal. Its suitability depends on the context, and it can be used in various settings.

What's the difference between "ready to combine" and "about to mix"?

"Ready to combine" suggests a state of preparedness for merging elements, while "about to mix" implies the action of mixing is imminent. The former focuses on readiness, the latter on the timing of the action.