Your English writing platform
Discover LudwigSuggestions(1)
Exact(59)
Sequences obtained for each sample were searched for the adapter sequence (AGATCGGAAGAGCACACGTCTGAACTCCAG) and read ends trimmed back when they could represent adapter sequence.
For A. cryptoceras, only read ends were trimmed to Q20.
The Roche 454 read ends were additionally screened and trimmed for 454 adapter sequences.
Only read ends that make unique concordant pairs are used in the downstream analyses.
The extraction was made both with and without clipping of read ends.
Reads were subsequently divided into different classes based on mapping position and orientation of read ends.
Insertions and deletions (indels) near the read ends have a much bigger impact on the alignments, and hence might lead to even wider blind spots near the read ends.
The results show that the trimming of low-quality bases at the sequence read ends improved the assembly significantly.
That is, one of the two read ends is aligned such that the SV is part of the unaligned read.
Adapter sequences detected were trimmed from read ends using FastqMcf from ea-utils v1.1.2 (https://code.google.com/p/ea-utils).
Similar(1)
We did not remove read ends our alignment was done to the transcriptome, and thus the splicing-junction-related misalignments that are known to introduce errors at the reads' ends are not expected.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com