Sentence examples for read as containing from inspiring English sources

There is no evidence from the renaissance and baroque that any painting was intended to be or was read as containing a code - taking the definition of a code as a concealed message that is quite different from what is immediately apparent.

But Judge Hernandez did allow that a single post published on Christmas Day in 2010 charging all manner of criminal conduct could be read as containing "provable assertions of fact". A one-day trial took place on Nov. 29, and after deliberating for 75 minutes, the jury awarded Obsidian $1 million and Mr. Padrick $1.5 million.

Specifically, we classified reads as containing an L1 or Alu element if there was a match to, respectively, the reverse complement of the L1Hs-specific sequence TGCACATGTACCCTAAAACTTAG or the reverse complement of the AluYb8-specific sequence ACTGCAGTCCGCAGTCCG (allowing for a maximum of 6 mismatches).

If she isn't a jolly, rotund Italian mamma, it is what she calls her negative edge - which I read as contained cynicism - that makes her a writer, the Conrad of the kitchen.

Then provide content that is meaningful and fun to read, as well as containing keywords for search engine optimization.

Although few read as obviously pornographic, many contain subliminal sexual messages.

It contains read as well as update transactions.

Read as much as possible.

Each droplet is read as either containing amplifiable target sequence (positive fluorescence above a threshold) or not, yielding a binary (digital) readout.

The sequences from unmasked portions of reads identified as containing SVA_A (28,007 reads or 0.042% of total sequenced reads) were filtered for Illumina adapters and primers.

Yoga has been around for thousands of years, and the yoga sutras are beautiful to read as they contain so much wisdom and knowledge.