Sentence examples for reactivated using from inspiring English sources

AChE enzyme was successfully reactivated using 2-pyridine aldoxime methiodide.

Experiments confirmed that the adsorbed film can be removed and the electrode surface reactivated using brief polarization at +2.5 V.

BCBL-1 cells were reactivated using TPA (20 ng/ml) for the designated time.

On the other hand, silenced tumour suppressor genes [ 41] could be reactivated using targeted DNA demethylation.

Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry.

293T BAcellsells were transfected with either mock or a second control luciferase-specific siRNA (Griffiths and Whitehouse, 2007) and concurrently reactivated using TPA.

Correct gene targeting was confirmed by Southern blotting or RT-PCR for expression of the reactivated Hprt using human_ HPRT_exon1_forward CAGGCGAACCTCTCGGCTTT and mouse_ Hprt_exon3_reverse GTGATGGCCTCCCATCTCCTT primers.

In the UK, according to Mastaglio, there is a "gold standard" that means it is impossible for a firearm to be reactivated and used.

If the player gathers all the parts, Dr. Cain states he will attempt to reassemble and reactivate Zero using his original control chip.

To explore whether targeting of B5 could block the amplification of virus that had reactivated, we used an explant co-cultivation model.

Based on our investigations we generally recommend using reactivated GAC to reduce the environmental impact and to carry out tests on pilot scale to collect reliable data for process design.