Sentence examples for randomized nucleotide from inspiring English sources

They screened individually the frequency of meiotic recombination in ∼46,000 fission yeast strains harboring short, randomized nucleotide sequences within a test locus.

Furthermore, comparison with the expected amino acid composition of randomized nucleotide sequences (white squares and dotted regression line) suggest that real amino acid sequences are less GARP biased then expected by chance alone.

Mutagenesis of Pro was performed using synthetic double-stranded primers (sense primer, 5′-GCTAATTATGGGTTGCTGC NNNGGAGGAACTGGCTCC-3′; and antisense primer, 5′-GGAGCCAGTTCCTCC NNNGCAGCAACCCATAATTAGC-3′; where the underlined portions represent the Pro codon, and N indicates a randomized nucleotide).

Compared to error prone PCR and DNA shuffling, randomized nucleotides primers generate a higher percentage of clones containing amber stop codons within the CDR3 region.

First, we designed a primer that carries 19 randomized nucleotides, named R-H1-siRNA-3.2, 5'-AACACAAGTAGCTATCCATCTCGAGN19AGGGGATCCTGGTCTCATAC; part of its sequences is shown in Fig. 1 step A, as indicated by an arrow.

A: Incorporation of 19 randomized nucleotides into PCR products: Since a sequence carrying 19-29 nucleotides has been shown to efficiently suppress its cognate genes (8, 21), we used a 19 base siRNA to illustrate how shRNAs can be generated from randomized oligonucleotides.

There are several possible approaches for randomizing nucleotide sequences while maintaining their N-mer oligonucleotide frequency composition.

By simulation, we randomized the nucleotide sequences of human intron-exon database but maintaining the same exon-intron structure and nucleotide compositions (see Methods).

Live S. pyogenes cells were incubated with DNA libraries consisting of 40-nucleotides randomized sequences.

(3 Order of nucleotides randomized per sequence.

Single D and J segments are selected stochastically and recombined in a manner that introduces randomized, non-templated nucleotides at the recombination junction.