Sentence examples for quantitative apparatus from inspiring English sources

Concentration of C-reactive protein in capillary blood, with quantitative apparatus (QuikRead of Orion Diagnostica).

Rather than small quantitative changes, this apparatus allows for "quantum leaps" through the creation of new genes and enzymes.

This apparatus allowed quantitative analysis of the films.

The oculomotor system is ideal as it has been extensively utilized for quantitative analysis; however, no complete apparatus exists to both elicit and measure the eye movements in small genetic model organisms in real time.

The good agreement is remarkable also when considering that the experiments used as reference were not designed for a quantitative analysis of the photosynthetic apparatus but to elucidate the role of a specific protein, PufX.

Although our results clearly demonstrate that the link between process costs and GC content is readily transformed by differences in the translational apparatus, more concrete quantitative aspects of the current model should be interpreted with caution.

Comparative analysis of transgene copy number in embryos was performed on DNA extracted from yolk sac or EPC (ectoplacental cone) by quantitative PCR using MyiQ Bio-Rad apparatus and the following primers: forward: 5'GandGGTGGATTTGGTGCTC3' and reverse: 5'TCACTGCATTCTAGTTGTGG3'.

Chromatographic separation and quantitative analysis were performed using HPLC apparatus (Merck-Hitachi, Darmstadt, Germany) equipped with C18 column (5 μm LiChrosphere 250 × 4 mm, Merck) and UV Vis detector at 215 nm.

However, the present analysis is not strictly quantitative because of the difference in experimental apparatus, and thus the data should be considered semi-quantitative.

SOD1 G93Adl B6 mice were subject to quantitative grip-strength assessment using a commercial apparatus (BioSeb, Chaville, France).

Quantitative or qualitative differences in the recombination apparatus may also cause the overall excess of recombination in honey bees.